View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2024R-Insertion-11 (Length: 59)
Name: NF2024R-Insertion-11
Description: NF2024R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2024R-Insertion-11 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 52; Significance: 1e-21; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 52; E-Value: 1e-21
Query Start/End: Original strand, 8 - 59
Target Start/End: Original strand, 25338390 - 25338441
Alignment:
| Q |
8 |
acattgggagtggcagccagaagattgcaccttgccaaggtaatttccacac |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25338390 |
acattgggagtggcagccagaagattgcaccttgccaaggtaatttccacac |
25338441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 9 - 44
Target Start/End: Original strand, 5230630 - 5230665
Alignment:
| Q |
9 |
cattgggagtggcagccagaagattgcaccttgcca |
44 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5230630 |
cattgggagtggcagccagaagattgtaccttgcca |
5230665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University