View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2024R-Insertion-8 (Length: 168)
Name: NF2024R-Insertion-8
Description: NF2024R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2024R-Insertion-8 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 9 - 168
Target Start/End: Original strand, 52087541 - 52087700
Alignment:
| Q |
9 |
gaatctactatggatcatgtgagtgaaattgaaagatgaaatggaattggaggattgaatacttaccaacggacccatagtcaagtgaagtggctcttca |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
52087541 |
gaatctactatggatcatgtgagtgaaattgaaagatgaaatggaattggaggattgaatacttaccaacggacccatagttaagtgaagtggctcttca |
52087640 |
T |
 |
| Q |
109 |
agagagataagggaattcacttgcttcaccatggaatcaatcgctgattgtggaacgtct |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52087641 |
agagagataagggaattcacttgcttcaccatggaatcaatcgctgattgtggaacgtct |
52087700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University