View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2024R-Insertion-9 (Length: 116)
Name: NF2024R-Insertion-9
Description: NF2024R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2024R-Insertion-9 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 77; Significance: 3e-36; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 77; E-Value: 3e-36
Query Start/End: Original strand, 7 - 116
Target Start/End: Complemental strand, 8798024 - 8797915
Alignment:
| Q |
7 |
caggggtattagtggcagtgcagaaaaaggaaggtagagttttcattgggaaggtaaaaccnnnnnnngacaccaatgcctcacactaacccttcttctg |
106 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |||||||||||||||||||| |
|
|
| T |
8798024 |
caggggtatcagtggcagtgcagaaaaaggaaggtagagttttcattgggaaggtaaaacctttttttggcaccaatgcttcacactaacccttcttctg |
8797925 |
T |
|
| Q |
107 |
taactcaacc |
116 |
Q |
| |
|
|||||||||| |
|
|
| T |
8797924 |
taactcaacc |
8797915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University