View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2024_high_20 (Length: 229)
Name: NF2024_high_20
Description: NF2024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2024_high_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 4152685 - 4152480
Alignment:
| Q |
1 |
ggaagaaggaggaaacaaaagaagaatgatcgtggaggtaaagaacctagaaaagaaggcattttcatttttgtgatatagaaaatggaagaagaaaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4152685 |
ggaagaaggaggaaacaaaagaagaatgatcgtggaggtaaagaacctagaaaagaaggcattttcatttttgtgatatagaaaatggaagaagaaaaaa |
4152586 |
T |
|
| Q |
101 |
gaatgagtttatttgggatatggtactatatatggtgattcataggttgtgcaaggaaggtatatcttccctctctcattgcaaat---caacatcaaaa |
197 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| | || ||||| |
|
|
| T |
4152585 |
gaatgagtttatttgggatatggtactat--------attcgtaggttgtgcaaggaaggtatatcttccctctctcattgcaaatgtgctactgcaaaa |
4152494 |
T |
|
| Q |
198 |
agtgccaatttaat |
211 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
4152493 |
agtgccaatttaat |
4152480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 4159891 - 4159788
Alignment:
| Q |
1 |
ggaagaaggaggaaacaaaagaagaatgatcgtggaggtaaagaacctagaaaagaaggcattttcatttttgtgatatagaaaatggaagaagaaaaaa |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||| | | |||||||| || |||||||||||||||||||||| ||| | |||||||||| |||||| |
|
|
| T |
4159891 |
ggaagaaggatgaaacaaaagaagaatgagcgtggatgaatagaacctaaaagagaaggcattttcatttttgtgctat-ggaaatggaaga--aaaaaa |
4159795 |
T |
|
| Q |
101 |
gaatgag |
107 |
Q |
| |
|
||||||| |
|
|
| T |
4159794 |
gaatgag |
4159788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University