View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2024_low_20 (Length: 257)
Name: NF2024_low_20
Description: NF2024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2024_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 42 - 246
Target Start/End: Original strand, 5664388 - 5664592
Alignment:
| Q |
42 |
ggataaacgccaaaaacatatttgacaccataccacctatgcataataagcaccccaacatcctaatgcatagccaatacaaccagaaggtccttacaag |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5664388 |
ggataaacgccaaaaacatatttgacaccacaccacctatgcataataagcaccccaacatcctaatgcatagccaatacaaccagaaggtccttacaag |
5664487 |
T |
 |
| Q |
142 |
ttacatcaccagaattccatcatggtgtctattgttgacacagtttgaattagcaccattcaaaaagtatctaattaaactcatttcgtgtgttctctct |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5664488 |
ttacatcaccagaattccatcatggtgtctattgttgacacagtttgaattagcaccattcaaaaagcatctaattaaactcatttcgtgtgttctctct |
5664587 |
T |
 |
| Q |
242 |
ttctt |
246 |
Q |
| |
|
||||| |
|
|
| T |
5664588 |
ttctt |
5664592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University