View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2024_low_26 (Length: 238)
Name: NF2024_low_26
Description: NF2024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2024_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 40960903 - 40961123
Alignment:
| Q |
1 |
ttgcacagagcgtaaagtgggtgtaagggatattattcgcgcaggacttgctgaccgatatatggtttgcaccttaatgctttactgatatttaattaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40960903 |
ttgcacagagcgtaaagtgggtgtaagggatattattcgtgcaggacttgctgaccgatatatggtttgcaccttaatgctttactgatatttaattaaa |
40961002 |
T |
 |
| Q |
101 |
atttaaaaactcatctaatgcacttttaatgacccgggttttgattgttgctctgcttgttcagctggaatgtatcgcctgtggtcattcttggtctgct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40961003 |
atttaaaaactcatctaatgcacttttaatgacccgggttttgattgttgctctgcttgttcagctggaatgtatcgcctgtggtcattcttggtctgcc |
40961102 |
T |
 |
| Q |
201 |
tcttgtgatgcggtgtctgtg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
40961103 |
tcttgtgatgcggtgtctgtg |
40961123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 26 - 221
Target Start/End: Original strand, 40947740 - 40947929
Alignment:
| Q |
26 |
agggatattattcgcgcaggacttgctgaccgatatatggtttgcaccttaatgctttactgatatttaattaaaatttaaaaactcatctaatgcactt |
125 |
Q |
| |
|
||||||||||| || |||||| |||||||||||||||||| || |||||||||||||||||||||| | ||| | ||| |||||| || | || |
|
|
| T |
40947740 |
agggatattatccgtgcaggatatgctgaccgatatatggtcagcgccttaatgctttactgatatttca----aatatcaaat-tcatctcctgtagtt |
40947834 |
T |
 |
| Q |
126 |
ttaatgacccgggttttgattgttgctctgcttgttcagctggaatgtatcgcctgtggtcattcttggtctgcttcttgtgatgcggtgtctgtg |
221 |
Q |
| |
|
|| |||| ||||| ||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| ||| ||||||||||||||||| |
|
|
| T |
40947835 |
tttgtgacttcggttta-atttttgctctgcttgttcagctggaatgcatagcttgtggtcattcctggtctgcctctcgtgatgcggtgtctgtg |
40947929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University