View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2024_low_29 (Length: 226)
Name: NF2024_low_29
Description: NF2024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2024_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 90 - 201
Target Start/End: Original strand, 43596683 - 43596799
Alignment:
| Q |
90 |
taatagattcttttggagaagatgtctcattgttagttcgttgatcgaatcagaaatggatgcgatgcggtggatt----actccatctgcgt-aaagtg |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
43596683 |
taatagattcttttggagaagatgtctcattgttagttcgttgatcgaatcagaaatggatgcgatgcggtggattactcactccatctgcgtaaaagtg |
43596782 |
T |
 |
| Q |
185 |
gaacagaaatgaaaatg |
201 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
43596783 |
gaacagaaatgaaaatg |
43596799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University