View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20250_high_9 (Length: 382)
Name: NF20250_high_9
Description: NF20250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20250_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 325; Significance: 0; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 12 - 360
Target Start/End: Original strand, 33519366 - 33519714
Alignment:
| Q |
12 |
agtgagatgaattaaaagaaaatggctatatcgttctttcttagtaactttttccgctcttctgatggcaaggttactagatcccctagtttttggcgag |
111 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33519366 |
agtgacatgaattaaaagaaaatggctctatcgttctttcttagtaactttttccgctcttctgatggcaaggttactagatcccctagtttttggcgag |
33519465 |
T |
|
| Q |
112 |
taccctgctgatatgcgctctattcttgggagccagttgcctaggttctcatctaaggagaagagcctcctaagaggcagcctggacttcattggcatca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33519466 |
taccctgctgatatgcgctctattcttgggagccagttgcctaggttctcatctaaggagaagagcctcctaagaggcagcctggacttcattggcatca |
33519565 |
T |
|
| Q |
212 |
ataactacggggctctctatgccaaggaatgctacctctcaacttgccctctcgaagcagctcgtccaataaaaggctttttgcaaacaacaggaatgag |
311 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
33519566 |
ataactacggggctctctatgccaaggattgctacctctctacttgccctctcgaagcagctcgtccaataaaaggctttttgcaaacaactgggatgag |
33519665 |
T |
|
| Q |
312 |
agatggcattccaattggtgatcaggtactcatatgtagtccaactgtt |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33519666 |
agatggcattccaattggtgatcaggtactcatatgtagtccaactgtt |
33519714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 183; E-Value: 7e-99
Query Start/End: Original strand, 81 - 363
Target Start/End: Complemental strand, 33496521 - 33496239
Alignment:
| Q |
81 |
aaggttactagatcccctagtttttggcgagtaccctgctgatatgcgctctattcttgggagccagttgcctaggttctcatctaaggagaagagcctc |
180 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| || |||||| | | |||| | ||||||||||| ||| |
|
|
| T |
33496521 |
aaggttactagatcccctagtttttggtgagtaccctgctgagatgcgctctattcttgggaaccggttgccaaagatctctacgaaggagaagagtctc |
33496422 |
T |
|
| Q |
181 |
ctaagaggcagcctggacttcattggcatcaataactacggggctctctatgccaaggaatgctacctctcaacttgccctctcgaagcagctcgtccaa |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| ||||||||||| ||||| || ||||| ||||||||||||| |
|
|
| T |
33496421 |
ctaagaggcagcctggacttcattggcatcaataactatggagctctctatgccaaggattgctacctctctacttgtccactcgaggcagctcgtccaa |
33496322 |
T |
|
| Q |
281 |
taaaaggctttttgcaaacaacaggaatgagagatggcattccaattggtgatcaggtactcatatgtagtccaactgttctt |
363 |
Q |
| |
|
||| ||||||| || ||||||| || |||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
33496321 |
taagaggctttctggaaacaactgggatgagagatggcattccaattggtgatcaggtactcgtatgtagtccaactgctctt |
33496239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University