View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20250_low_14 (Length: 366)
Name: NF20250_low_14
Description: NF20250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20250_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 253; Significance: 1e-140; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 79 - 347
Target Start/End: Complemental strand, 39426961 - 39426693
Alignment:
| Q |
79 |
aataaattattatgatgatattatggattcaaagtaacttggaaccaaggagaatgtagcacaacattggacatcataaaatagttcaaaatgacaaatt |
178 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39426961 |
aataagttattatgatgatattatggattcaaagtaacttggaaccaaggagaatgtagcacaacattggacatcataaaatagttcaaaatgacaaatt |
39426862 |
T |
 |
| Q |
179 |
ttggaaccaaggagaatgtaatttggaaatttaacatggcactcgtgaatttctacacaggagcaaaacaatttcaatgcatgcaacataacccatttat |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39426861 |
ttggaaccaaggagaatgtaatttggaaatttaacatggcactcatgaatttctacacaagagcaaaacaatttcaatgcatgcaacataacccatttat |
39426762 |
T |
 |
| Q |
279 |
ttttactatgtaatttcttaaaacataatcactttatggaaataggagaacataatttcacccaaaacc |
347 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39426761 |
ttttattatgtaatttcttaaaacataatcactttatggaaataggagaacataatttcacccaaaacc |
39426693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University