View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20250_low_23 (Length: 305)
Name: NF20250_low_23
Description: NF20250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20250_low_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 255; Significance: 1e-142; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 17 - 295
Target Start/End: Original strand, 37341917 - 37342195
Alignment:
| Q |
17 |
actaaggagaggggagaacaagaggatatcacattatagatttatacagctgtatatacaaaaaccaatttcacaaacaacaagttcattcgcaatagaa |
116 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37341917 |
actaaggagaggggagaacaagagggtatcacattatagatttatacagctatatatacaaaaaccaatttcacaaacaacaaactcattcgcaatagaa |
37342016 |
T |
|
| Q |
117 |
aatttgcaccttcctacaatggcacgtctagttttcttgatatgtttatttttcttcttacctacggtaatgtcatacgattttcttgtcctagctctac |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37342017 |
aatttgcaccttcctacaatggcacgtctagttttcttgatatgtttatttttcttcttacctacggtaatgtcatgcgattttcttgtcctagctctac |
37342116 |
T |
|
| Q |
217 |
aatggccaataacctattgtaggtcaccatccaattgcaggacagggcttccacaaagtttaacaatacgcggtctgtg |
295 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37342117 |
aatggccaataacctattgtaggccaccatccaattgcaggacagggcttccacaaagtttaacaatacgcggtctgtg |
37342195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 242 - 287
Target Start/End: Complemental strand, 37334833 - 37334788
Alignment:
| Q |
242 |
accatccaattgcaggacagggcttccacaaagtttaacaatacgc |
287 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
37334833 |
accatccaattgcaggacatggcttccattaagtttaacaatacgc |
37334788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University