View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20250_low_41 (Length: 220)
Name: NF20250_low_41
Description: NF20250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20250_low_41 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 13 - 204
Target Start/End: Original strand, 40511304 - 40511486
Alignment:
| Q |
13 |
gagaagaacaccatctcaattggattaaagtaaggggataaagcaataaaaatgtaaaatagttctaagttttagtcactatacgttgccactatgtttt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
40511304 |
gagaagaacaccatctcaattggattaaagtaaggggataaagcaataaaaatgtaaaatagttgtaagttttagtcac---------ccactatgtttt |
40511394 |
T |
|
| Q |
113 |
gccatgggcatggacacatgacacaatattgacaccaacaccttgacgccaataaaaatatacaaaaattgaaaaagattgaatgtaaccat |
204 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40511395 |
gccatgggcatagacacatgacacaatattgacaccaacacctcgacgccaataaaaatatacaaaaattgaaaaagattgaatgtaaccat |
40511486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University