View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20250_low_41 (Length: 220)

Name: NF20250_low_41
Description: NF20250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20250_low_41
NF20250_low_41
[»] chr5 (1 HSPs)
chr5 (13-204)||(40511304-40511486)


Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 13 - 204
Target Start/End: Original strand, 40511304 - 40511486
Alignment:
13 gagaagaacaccatctcaattggattaaagtaaggggataaagcaataaaaatgtaaaatagttctaagttttagtcactatacgttgccactatgtttt 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||         ||||||||||||    
40511304 gagaagaacaccatctcaattggattaaagtaaggggataaagcaataaaaatgtaaaatagttgtaagttttagtcac---------ccactatgtttt 40511394  T
113 gccatgggcatggacacatgacacaatattgacaccaacaccttgacgccaataaaaatatacaaaaattgaaaaagattgaatgtaaccat 204  Q
    ||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
40511395 gccatgggcatagacacatgacacaatattgacaccaacacctcgacgccaataaaaatatacaaaaattgaaaaagattgaatgtaaccat 40511486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University