View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20250_low_42 (Length: 219)

Name: NF20250_low_42
Description: NF20250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20250_low_42
NF20250_low_42
[»] chr2 (3 HSPs)
chr2 (1-88)||(32741148-32741235)
chr2 (85-147)||(32733861-32733922)
chr2 (179-218)||(32733823-32733862)
[»] chr3 (2 HSPs)
chr3 (1-86)||(11119446-11119531)
chr3 (1-71)||(12205970-12206040)


Alignment Details
Target: chr2 (Bit Score: 72; Significance: 6e-33; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 32741235 - 32741148
Alignment:
Q  1 gtagtgatgatggtgattcaattataggcacacgcttttatgatagtgaagaagagaggatggctgcggttgatgatgggtttgataa 88  Q
    |||||||||||||||||| ||||| ||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||    
T  32741235 gtagtgatgatggtgatttaattaaaggcacacgctttgatgatagtgaagaagagaagatggctgcggttgatgatgggtttgataa 32741148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 85 - 147
Target Start/End: Complemental strand, 32733922 - 32733861
Alignment:
Q  85 ataaaaatttcacacaaacgcaacggtagaaatgggccgggtaaaaagcggagtaactttact 147  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||  ||||||||||||    
T  32733922 ataaaaatttcacacaaacgcaacggtagaaatggg-cgggtaaaaagctcagtaactttact 32733861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 218
Target Start/End: Complemental strand, 32733862 - 32733823
Alignment:
Q  179 cttcaaacctacttgagcaacacgaggacacacaaaaccc 218  Q
    |||||||| ||||||||||||||||| |||||||||||||    
T  32733862 cttcaaacttacttgagcaacacgagtacacacaaaaccc 32733823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 58; Significance: 1e-24; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 1 - 86
Target Start/End: Complemental strand, 11119531 - 11119446
Alignment:
Q  1 gtagtgatgatggtgattcaattataggcacacgcttttatgatagtgaagaagagaggatggctgcggttgatgatgggtttgat 86  Q
    |||||||||||||||||||||| | |||||||| |||| |||| |||||||||||||||||||||| |||||||||| ||||||||    
T  11119531 gtagtgatgatggtgattcaatcaaaggcacacactttaatgacagtgaagaagagaggatggctggggttgatgataggtttgat 11119446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 12206040 - 12205970
Alignment:
Q  1 gtagtgatgatggtgattcaattataggcacacgcttttatgatagtgaagaagagaggatggctgcggtt 71  Q
    |||||||||||||||||||||||| |||| ||| |||| ||||||||||||||||||||||||||| ||||    
T  12206040 gtagtgatgatggtgattcaattaaaggcgcacactttaatgatagtgaagaagagaggatggctggggtt 12205970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University