View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20251_low_4 (Length: 309)
Name: NF20251_low_4
Description: NF20251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20251_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 5 - 166
Target Start/End: Complemental strand, 556465 - 556304
Alignment:
| Q |
5 |
tttccttgcattgcaatattgttctcttcaaataatgcacgcctgcataatctctaattcacttacccaagtgaataattatagttttattcatgtcaat |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |||| |||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
556465 |
tttccttgcattgcaatattgttctcttcaaataaagcacgcatgcacaatctctaattcacttgcccaagtgaataatgatagttttattcatgtcaat |
556366 |
T |
|
| Q |
105 |
gtagctggatttctagtgcgggatatacacgaatttagctttgtgaatttaggttgatatgt |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
556365 |
gtagctggatttctagtgcgggatatacacgaatttagctttgtgaatttaggttgatatgt |
556304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 129; E-Value: 9e-67
Query Start/End: Original strand, 161 - 297
Target Start/End: Complemental strand, 553011 - 552875
Alignment:
| Q |
161 |
atatgttcgattaatcttgcatgtgttgatcaatgttgaatctttaatgcaggtgagtgcataatgaacatgtggcataagatgagtgcgtcggaaatta |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | |
|
|
| T |
553011 |
atatgttcgattaatcttgcatgtgttgatcaatgttgaatctttaatgcaggtgagtgcaaaatgaacatgtggcataagatgagtgcgtcggaaatga |
552912 |
T |
|
| Q |
261 |
ttttgtaattatagggagtatatttggtggtgttagt |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
552911 |
ttttgtaattatagggagtatatttggtggtgttagt |
552875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University