View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20251_low_7 (Length: 203)
Name: NF20251_low_7
Description: NF20251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20251_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 4e-77; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 24 - 189
Target Start/End: Complemental strand, 2303007 - 2302842
Alignment:
| Q |
24 |
gatacatacttgataccatatgcagattgcagttactggaatgaagatgataaatacttgccatgctgcctgacacatcaccgcaatagtgccaagaatt |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || |||||||||||||||||||||||||||||| |
|
|
| T |
2303007 |
gatacatacttgataccatatgcagattgcagttactggaatgaagatgataaatacttgccaagccgcttgacacatcaccgcaatagtgccaagaatt |
2302908 |
T |
|
| Q |
124 |
tgtattattgagaaagcacaccatcctattttgtttgccatttctaagtctagcacaccttcatct |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
2302907 |
tgtattattgagaaagcacaccatcctattttatttgccatttctaagtctagcacaccttgatct |
2302842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 41 - 153
Target Start/End: Complemental strand, 2310417 - 2310305
Alignment:
| Q |
41 |
atatgcagattgcagttactggaatgaagatgataaatacttgccatgctgcctgacacatcaccgcaatagtgccaagaatttgtattattgagaaagc |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || || |||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2310417 |
atatgcagattgcagttactggaatgaagatgataaatacttgccaagccgcttgacacatcaccgcaatagtgccaagaatttgtattattgaggaagc |
2310318 |
T |
|
| Q |
141 |
acaccatcctatt |
153 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
2310317 |
acacgatcctatt |
2310305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University