View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20252_low_4 (Length: 273)
Name: NF20252_low_4
Description: NF20252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20252_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 15 - 267
Target Start/End: Complemental strand, 37672369 - 37672117
Alignment:
| Q |
15 |
actttagaccttgccaaaacattcgtggaaaaggatcagacttacgcaatcagagtgcatgtgattttaaatgtgtccttgacaattaatttggnnnnnn |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37672369 |
actttagaccttgccaaaacattcgtggaaaaggatcagacttacgcaatcagagtgcatgtgattttaaatgtgtccttgacaattaatttggtttttt |
37672270 |
T |
 |
| Q |
115 |
ngttttgtttgagggaacaattagtttggttatccttttggattgtagagaatggttggttttccttttgggttgttatccaaacaggttttgagcatgt |
214 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37672269 |
ttgtttgtttgagggaacaattaatttggttatccttttggattgtagagaatggttggttttccttttggattgttatccaaacaggttttgagcatgt |
37672170 |
T |
 |
| Q |
215 |
gttctatgttttgtgggttgcatgtgatggtcttggtgatcttcttgatgatg |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37672169 |
gttctatgttttgtgggttgcatgtgatggtcttggtgatcttcttgatgatg |
37672117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 171 - 245
Target Start/End: Original strand, 36170605 - 36170679
Alignment:
| Q |
171 |
tggttttccttttgggttgttatccaaacaggttttgagcatgtgttctatgttttgtgggttgcatgtgatggt |
245 |
Q |
| |
|
||||||||||||||||| |||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170605 |
tggttttccttttgggtagttatcaaaacgggttttgagcatgtgttctatgttttgtgggttgcatgtgatggt |
36170679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University