View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20252_low_5 (Length: 226)

Name: NF20252_low_5
Description: NF20252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20252_low_5
NF20252_low_5
[»] chr8 (1 HSPs)
chr8 (8-98)||(11404222-11404312)


Alignment Details
Target: chr8 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 11404222 - 11404312
Alignment:
8 ggtagattatacttttctccctttcaagtttttcctctagtttttaactaacaccaaccccgaatttttcattaaaagtgacaaattaagg 98  Q
    |||| ||||||||||||| ||||||||||||||  |||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
11404222 ggtaaattatacttttcttcctttcaagttttttatctagtatttaactaacaccaaccccgaatttttcattaaaagtgacaaattaagg 11404312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University