View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20253_high_5 (Length: 279)
Name: NF20253_high_5
Description: NF20253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20253_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 7 - 264
Target Start/End: Complemental strand, 113455 - 113198
Alignment:
| Q |
7 |
ttgcaatcttcaatcacgagtcttactttaaaatttccccaccactctattaaacattctctttagttttgtaatactactcaacaccaacggtttataa |
106 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
113455 |
ttgcaatcttcagtcacgagtcttgctttaaaatttccccaccactctattaaacattctctttagttttgtaatactactcaacaccaatggtttataa |
113356 |
T |
|
| Q |
107 |
tccttggatagttccgaggattgttattcacaattgatttgatctcctatttcatgacatgcctcatattttatcttttataatgtcgtcaaaaccaaaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
113355 |
tccttggatagttccgaggattgttattcacaattgatttgatctcctatttcatgacttgcctcatattttatctttcataatgtcgtcaaaaccaaaa |
113256 |
T |
|
| Q |
207 |
gggtttgctatctaccaaaaaccaatatttaaggttaagactaaatatcccttcataa |
264 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
113255 |
gggtttgctatctaccaaaaaccaatattcaaggttaagactaaatatcccttcataa |
113198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University