View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20253_low_10 (Length: 257)
Name: NF20253_low_10
Description: NF20253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20253_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 23 - 248
Target Start/End: Original strand, 40854357 - 40854583
Alignment:
| Q |
23 |
ggtgattgttgtacaagtcagcactggtgaaaatattttagcattatatccactattttcttag-atttttacaccgaaacagatgacaaatatatattt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
40854357 |
ggtgattgttgtacaagtcagcactggtgaaaatatttcagcattatatccactattttcttaggatttttacaccgaatcagatgacaaatatatattt |
40854456 |
T |
 |
| Q |
122 |
tggaaaactattatcaacttgtttgactcttattatgttttgcagctatggttcgaaaggaaattgaagatgaaactaatagagtgactgggaaatcaaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40854457 |
tggaaaactattatcaacttgtttgactcttattatgttttgcagctatggttcgaaaggaaattgaagatgaaactaatagagtgactgggaaatcaaa |
40854556 |
T |
 |
| Q |
222 |
caagatatctcctgttcctattcatct |
248 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
40854557 |
caagatatctcctgttcctattcatct |
40854583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University