View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20253_low_4 (Length: 345)
Name: NF20253_low_4
Description: NF20253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20253_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 20 - 326
Target Start/End: Complemental strand, 47620035 - 47619729
Alignment:
| Q |
20 |
tcaccatcaccaccattactaattaatcatcaaaattcataattaatattatgagtagcgaggaaatagtgttacagggaggaggagtctgcgaaaacga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47620035 |
tcaccatcaccaccattactaattaatcatcaaaattcataattaatattatgagtagcgaggaaatagtgttacagggaggaggagtctgcgaaaacga |
47619936 |
T |
|
| Q |
120 |
gttttcagatcaagaggaagagttgcaacaggaacattctgatcagaaggccgaggcattggcgtttaagaaaaggaaacgtctaacaaagcaactatca |
219 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47619935 |
gttttcagatcaggaggaagagttgcaacaggaacattctgatcagaaggccgaggcattggcgtttaagaaaaggaaacgtctaacaaagcaactatca |
47619836 |
T |
|
| Q |
220 |
atgtgtggaacaccaggagacatggcgtgggaaagaaggcgtcgacaaactcaacgtaggaggaatagcatgcacgattgcaacgacgaagatctaaatg |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47619835 |
atgtgtggaacaccaggagacatggcgtgggaaagaaggcgtcgacaaactcaacgtaggaggaatagcatgcacgattgcaacgacgaagatctaaatg |
47619736 |
T |
|
| Q |
320 |
agcttag |
326 |
Q |
| |
|
||||||| |
|
|
| T |
47619735 |
agcttag |
47619729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University