View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20253_low_7 (Length: 288)
Name: NF20253_low_7
Description: NF20253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20253_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 18 - 285
Target Start/End: Original strand, 40942433 - 40942700
Alignment:
| Q |
18 |
catcacctccctttaaaatagtcttgcaaccttgacacccaaaaaaccacagcaaaggatagcatactttgatcctcttagtgcagtttannnnnnnaat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||| |
|
|
| T |
40942433 |
catcacctccctttaaaatagtcttgcaatcttgacacccaaaaaaccacagcaaaggatatcatactttgatcctcttagtgcagtttattttgttaat |
40942532 |
T |
|
| Q |
118 |
ggcttgatgccctttcgatttgcagtgtgacaagttagacaagctcttggttttattatctcaatcaatcatgcagatacttcccacttatggtggtcta |
217 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40942533 |
ggcttgatgccctttcgatttgcaatgtgacaagttagacaagctcttggttttattatctcaatcaatcatgcagatacttcccacttatggtggtcta |
40942632 |
T |
|
| Q |
218 |
ttaaagatcctttggatcagaggttttgtttcattgaatgttggaacaaacttatccttattcacgat |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40942633 |
ttaaagatcctttggatcagaggttttgtttcattgaatgttggaacaaacttgtccttattcacgat |
40942700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University