View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20253_low_9 (Length: 259)
Name: NF20253_low_9
Description: NF20253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20253_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 195
Target Start/End: Original strand, 3808401 - 3808602
Alignment:
| Q |
1 |
tcttttattgatactatatatatacata----aaagagaaaatgctaacaacannnnnnnnn--aacgctacaa-tacatagaaatattagcaaaccgaa |
93 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3808401 |
tcttttattgatactatatatatacatacataaaagagaaaatgctaacaacatttttttttttaacgctacaaatacatagaaatattagcaaaccgaa |
3808500 |
T |
 |
| Q |
94 |
aaagttgggatgtttgatatattgaggctgaacttgcactctccactttgctattagactctttaaaacaaacagaaaaaatatagatagcaaagtgtac |
193 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3808501 |
aaagttgggatgtttgatatattgaagctgaacttgcactctccactttgctattagactctttaaaacaaacagaaaaaatatagatagcaaagtgtac |
3808600 |
T |
 |
| Q |
194 |
ta |
195 |
Q |
| |
|
|| |
|
|
| T |
3808601 |
ta |
3808602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 197 - 226
Target Start/End: Original strand, 3808616 - 3808645
Alignment:
| Q |
197 |
taattagacatatttttcaagaatcgcttt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3808616 |
taattagacatatttttcaagaatcgcttt |
3808645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University