View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20254_high_15 (Length: 342)
Name: NF20254_high_15
Description: NF20254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20254_high_15 |
 | |
|
| [»] scaffold0754 (1 HSPs) |
| | |
|
| [»] scaffold0563 (2 HSPs) |
| | |
|
| [»] scaffold0492 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 1 - 326
Target Start/End: Original strand, 37147663 - 37147987
Alignment:
| Q |
1 |
gcttcacagagcagcgagtaccgccgcctcttgacagtggagggataacaggttgctgcacttctagcccgcaaagcctggtgagcctagccacatgaac |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| ||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
37147663 |
gcttcacagagcagcgagtactgccgcctcttgacagtggagggataacaggctgctgcactgctagcccacaaagcctggtgagcctagctacatgaac |
37147762 |
T |
|
| Q |
101 |
caccacttttttgtttcaagtgtcactaatatagtgcatagttctcttaccctgcaagcttctggtttttcagtcaggtcttttttgttgtttgataaca |
200 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37147763 |
caccactttt-tgtttcaagcgtcactaatatagtgcatagttctcttatcctgcaagcttctggtttttcagtcaggtcttttttgttgtttgataaca |
37147861 |
T |
|
| Q |
201 |
cgcgcgagatagagaagactatcatccatacaagctgcaagcagggtatataataagagttgcatcaattaatatttagtcactccttttcaccttccct |
300 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37147862 |
cacgcgagatagagaagactatcatccatacaagctgcaagcagggtatataataagagttgcatcaattaatatttagtcactccttttcaccttccct |
37147961 |
T |
|
| Q |
301 |
ctatttatatccctccttatcttcat |
326 |
Q |
| |
|
|||||||||||||||||||| ||||| |
|
|
| T |
37147962 |
ctatttatatccctccttattttcat |
37147987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 69; Significance: 6e-31; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 3 - 127
Target Start/End: Complemental strand, 46621473 - 46621349
Alignment:
| Q |
3 |
ttcacagagcagcgagtaccgccgcctcttgacagtggagggataacaggttgctgcacttctagcccgcaaagcctggtgagcctagccacatgaacca |
102 |
Q |
| |
|
||||||||||||| | ||| ||| |||||||||||||||||||||| || ||||||||||||| || | ||||||||||||||||||| ||||||| |
|
|
| T |
46621473 |
ttcacagagcagcaaacacctccgtctcttgacagtggagggataactggccgctgcacttctagtccaatatgcctggtgagcctagccacctgaacca |
46621374 |
T |
|
| Q |
103 |
ccacttttttgtttcaagtgtcact |
127 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
46621373 |
ccacttttttgtttcaagtgtcact |
46621349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 3 - 127
Target Start/End: Complemental strand, 46627199 - 46627070
Alignment:
| Q |
3 |
ttcacagagcagcgagtaccgccgcctcttgac----agtggagggataacaggttgctgcacttctagcccgcaaagcctggtgagcctagccacatga |
98 |
Q |
| |
|
||||||||||||| | ||| ||| |||||||| |||||||||||||| || |||||||||||||||| | ||||||||||||||||||| ||| |
|
|
| T |
46627199 |
ttcacagagcagcaaacacctccggctcttgacagtgagtggagggataactggccgctgcacttctagcccaatatgcctggtgagcctagccacttga |
46627100 |
T |
|
| Q |
99 |
accaccac-ttttttgtttcaagtgtcact |
127 |
Q |
| |
|
||||| || ||||||||||||||| ||||| |
|
|
| T |
46627099 |
accacaactttttttgtttcaagtatcact |
46627070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 3 - 115
Target Start/End: Complemental strand, 15800416 - 15800305
Alignment:
| Q |
3 |
ttcacagagcagcgagtaccgccgcctcttgacagtggagggataacaggttgctgcacttctagcccgcaaagcctggtgagcctagccacatgaacca |
102 |
Q |
| |
|
||||||||||||||| |||| | | ||| ||||||||||||||| || || |||||||||| || || ||||| | ||||||||||| | ||||||| |
|
|
| T |
15800416 |
ttcacagagcagcgaatacctctggctcctgacagtggagggattacgggctgctgcactttcagtccattaagcccgctgagcctagcctc-tgaacca |
15800318 |
T |
|
| Q |
103 |
ccacttttttgtt |
115 |
Q |
| |
|
|||||||||||| |
|
|
| T |
15800317 |
tcacttttttgtt |
15800305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 3 - 92
Target Start/End: Complemental strand, 15830000 - 15829911
Alignment:
| Q |
3 |
ttcacagagcagcgagtaccgccgcctcttgacagtggagggataacaggttgctgcacttctagcccgcaaagcctggtgagcctagcc |
92 |
Q |
| |
|
||||||||||||||| |||| | | ||| |||||||||||| ||||| ||||||||||| || || | ||||| ||||||||||||| |
|
|
| T |
15830000 |
ttcacagagcagcgaatacctctggctcccaacagtggagggactacaggctgctgcacttccagtccactaagcccggtgagcctagcc |
15829911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 3 - 92
Target Start/End: Complemental strand, 15831728 - 15831639
Alignment:
| Q |
3 |
ttcacagagcagcgagtaccgccgcctcttgacagtggagggataacaggttgctgcacttctagcccgcaaagcctggtgagcctagcc |
92 |
Q |
| |
|
||||||||||||||| |||| | | ||| |||||||||||| ||||| ||||||||||| || || | ||||| ||||||||||||| |
|
|
| T |
15831728 |
ttcacagagcagcgaatacctctggctcccaacagtggagggactacaggctgctgcacttccagtccactaagcccggtgagcctagcc |
15831639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 3 - 92
Target Start/End: Complemental strand, 15833455 - 15833366
Alignment:
| Q |
3 |
ttcacagagcagcgagtaccgccgcctcttgacagtggagggataacaggttgctgcacttctagcccgcaaagcctggtgagcctagcc |
92 |
Q |
| |
|
||||||||||||||| |||| | | ||| |||||||||||| ||||| ||||||||||| || || | ||||| ||||||||||||| |
|
|
| T |
15833455 |
ttcacagagcagcgaatacctctggctcccaacagtggagggactacaggctgctgcacttccagtccactaagcccggtgagcctagcc |
15833366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 3 - 110
Target Start/End: Original strand, 22654336 - 22654442
Alignment:
| Q |
3 |
ttcacagagcagcgagtaccgccgcctcttgacagtggagggataacaggttgctgcacttctagcccgcaaagcctggtgagcctagccacatgaacca |
102 |
Q |
| |
|
|||||| |||||||| |||| | | ||||||| ||||||||||||||| | |||||| |||||| || |||| |||||||||||||| | ||||||| |
|
|
| T |
22654336 |
ttcacatagcagcgaatacctctggctcttgatagtggagggataacaagctgctgcggttctagtccattaagcttggtgagcctagcctc-tgaacca |
22654434 |
T |
|
| Q |
103 |
ccactttt |
110 |
Q |
| |
|
||||||| |
|
|
| T |
22654435 |
tcactttt |
22654442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0754 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0754
Description:
Target: scaffold0754; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 3 - 92
Target Start/End: Original strand, 3923 - 4012
Alignment:
| Q |
3 |
ttcacagagcagcgagtaccgccgcctcttgacagtggagggataacaggttgctgcacttctagcccgcaaagcctggtgagcctagcc |
92 |
Q |
| |
|
||||||||||||||| |||| | | ||| |||||||||||| ||||| ||||||||||| || || | ||||| ||||||||||||| |
|
|
| T |
3923 |
ttcacagagcagcgaatacctctggctcccaacagtggagggactacaggctgctgcacttccagtccactaagcccggtgagcctagcc |
4012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0563 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: scaffold0563
Description:
Target: scaffold0563; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 3 - 92
Target Start/End: Original strand, 773 - 862
Alignment:
| Q |
3 |
ttcacagagcagcgagtaccgccgcctcttgacagtggagggataacaggttgctgcacttctagcccgcaaagcctggtgagcctagcc |
92 |
Q |
| |
|
||||||||||||||| |||| | | ||| |||||||||||| ||||| ||||||||||| || || | ||||| ||||||||||||| |
|
|
| T |
773 |
ttcacagagcagcgaatacctctggctcccaacagtggagggactacaggctgctgcacttccagtccactaagcccggtgagcctagcc |
862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0563; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 3 - 92
Target Start/End: Original strand, 10455 - 10544
Alignment:
| Q |
3 |
ttcacagagcagcgagtaccgccgcctcttgacagtggagggataacaggttgctgcacttctagcccgcaaagcctggtgagcctagcc |
92 |
Q |
| |
|
||||||||||||||| |||| | | ||| |||||||||||| ||||| ||||||||||| || || | ||||| ||||||||||||| |
|
|
| T |
10455 |
ttcacagagcagcgaatacctctggctcccaacagtggagggactacaggctgctgcacttccagtccactaagcccggtgagcctagcc |
10544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0492 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0492
Description:
Target: scaffold0492; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 3 - 92
Target Start/End: Original strand, 815 - 904
Alignment:
| Q |
3 |
ttcacagagcagcgagtaccgccgcctcttgacagtggagggataacaggttgctgcacttctagcccgcaaagcctggtgagcctagcc |
92 |
Q |
| |
|
||||||||||||||| |||| | | ||| |||||||||||| ||||| ||||||||||| || || | ||||| ||||||||||||| |
|
|
| T |
815 |
ttcacagagcagcgaatacctctggctcccaacagtggagggactacaggctgctgcacttccagtccactaagcccggtgagcctagcc |
904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University