View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20254_high_22 (Length: 301)
Name: NF20254_high_22
Description: NF20254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20254_high_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 18 - 285
Target Start/End: Original strand, 3661196 - 3661463
Alignment:
| Q |
18 |
gaacggaaatgggtttggattacacgtgctgcagaatgacgcggagattgagattgatgggtttgatgttgattgagagaagattcaagagattcaatgc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3661196 |
gaacggaaatgggtttggattacacgtgcagcagaatgacggagagattgagattgatgggtttgatgttgattgagagaagattcaagagattcaatgc |
3661295 |
T |
 |
| Q |
118 |
ggttaatgagagaagagagtgtagattgatgattttgatgaagggtttgtgatttggggtggtgtacgaggttgtcgtgtacgaggtggtcgtgtacgag |
217 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3661296 |
ggttaatgagagaagagagtgtggattgatgattttgatgaagggtttgtgatttggggtggtgtacgaggttgtcgtgtacgaggtggtcgtgtacgag |
3661395 |
T |
 |
| Q |
218 |
attgtggtgtacgaggtggttgagttgtggagaaaggaggacggaggaaatggtttgtacgaggtggt |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3661396 |
attgtggtgtacgaggtggttgagttgtggagaaaggaggacggaggaaatggtttgtatgaggtggt |
3661463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University