View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20254_high_30 (Length: 237)

Name: NF20254_high_30
Description: NF20254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20254_high_30
NF20254_high_30
[»] chr1 (1 HSPs)
chr1 (1-219)||(35481710-35481928)


Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 35481928 - 35481710
Alignment:
1 tgctgtagagtctgataaagctagaaacgtgattttggaggagctaaatggaaaggctgaagaggaggaagttgaagatgttgtattaaaagtacctgtt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| | ||||||||||||||||||||||||||||||    
35481928 tgctgtagagtctgataaagctagaaacgtgattttggaggagttgaatggaaaggctgaagaggagaaggttgaagatgttgtattaaaagtacctgtt 35481829  T
101 aatgtggtgagattgaagattggtgaagtagctgaggcgacctcggtggttgttttgcccgtgtgtaaagctgaggaaggagaaagggtgattatggaag 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35481828 aatgtggtgagattgaagattggtgaagtagctgaggcgacctcggtggttgttttgcccgtgtgtaaagctgaggaaggagaaagggtgattatggaag 35481729  T
201 caccttctgagataagaaa 219  Q
    |||||||||||||||||||    
35481728 caccttctgagataagaaa 35481710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University