View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20254_high_34 (Length: 220)

Name: NF20254_high_34
Description: NF20254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20254_high_34
NF20254_high_34
[»] chr6 (1 HSPs)
chr6 (52-201)||(34972516-34972665)


Alignment Details
Target: chr6 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 52 - 201
Target Start/End: Complemental strand, 34972665 - 34972516
Alignment:
52 gtatacagtgatagtcaaattcaaagcatatgctgcagataaatctacctaccttccacaaaatgataatactatttaacttgaacgaagttacatgaac 151  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
34972665 gtatacagtgatagtcaaattcaaagcatatgctgcagataaatctacttaccttccacaaaatgataatactatttaacttgaacgaagttacatgaac 34972566  T
152 aaccttgcatgtttcaacttttttaaaataataaaaaattgcattattgc 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
34972565 aaccttgcatgtttcaacttttttaaaataataaaaaattgcattattgc 34972516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University