View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20254_low_15 (Length: 358)
Name: NF20254_low_15
Description: NF20254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20254_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 9 - 345
Target Start/End: Original strand, 41854724 - 41855059
Alignment:
| Q |
9 |
tgtatgctctctgctatttatttcaccttcttcattgttttactcttctctattgtatagaattttctgaattgaaaggttatacagcctatatgctcca |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41854724 |
tgtatgctctctgctatttatttcaccttcttcattgttttactcttctctattgtatagaattttctgaattgaaaggttatacagcctatatgctcca |
41854823 |
T |
|
| Q |
109 |
gtaggcagtaggatgatacccctcatgatcagaaagagattgatcatgattggcaggagatctcttatttccaccttttttgttccgccattttcccgag |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41854824 |
gtaggcagtaggatgatacccctcatgatcagaaagagattgatcatgattggcaggagatctcttatttccaccttttttgttcctccattttcccgag |
41854923 |
T |
|
| Q |
209 |
tacaaactttttaactcaatgcaaaaccaatttttgtcatttataagaaaatacgaggtttggaggcaannnnnnnnnaaagtcaattggcattatcctt |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41854924 |
tacaaactttttaactcaatgcaaaaccaatttttgtcatttataagaaaatacgaggtttggaggc-ttttttttttaaagtcaattggcattatcctt |
41855022 |
T |
|
| Q |
309 |
taggttaccagggattgttagaacttcaacaagcttc |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41855023 |
taggttaccagggattgttagaacttcaacaagcttc |
41855059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University