View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20254_low_35 (Length: 220)
Name: NF20254_low_35
Description: NF20254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20254_low_35 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 52 - 201
Target Start/End: Complemental strand, 34972665 - 34972516
Alignment:
| Q |
52 |
gtatacagtgatagtcaaattcaaagcatatgctgcagataaatctacctaccttccacaaaatgataatactatttaacttgaacgaagttacatgaac |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34972665 |
gtatacagtgatagtcaaattcaaagcatatgctgcagataaatctacttaccttccacaaaatgataatactatttaacttgaacgaagttacatgaac |
34972566 |
T |
 |
| Q |
152 |
aaccttgcatgtttcaacttttttaaaataataaaaaattgcattattgc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34972565 |
aaccttgcatgtttcaacttttttaaaataataaaaaattgcattattgc |
34972516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University