View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20255_low_4 (Length: 367)
Name: NF20255_low_4
Description: NF20255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20255_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 6e-93; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 6e-93
Query Start/End: Original strand, 10 - 198
Target Start/End: Original strand, 37448759 - 37448947
Alignment:
| Q |
10 |
attattctaactaaattaatggttttcagcgctgatgcgctaaaggccagcaaacacatgttggtgtcggctaatcaactttactagcacgttttagtga |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37448759 |
attattctaactaaattaatggttttcagcgctgatgtgctaaaggccagcaaacacatgctggtgtcggctaatcaactttactagcacgttttagtga |
37448858 |
T |
|
| Q |
110 |
tcgattcccgcttgttatacttagatacccttatttttatcactgagtattttaaaaaataaaataattccattttccagtacaaagag |
198 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37448859 |
tcgattcccgcttgttatacttagatacctttattcttatcactgagtattttaaaaaataaaataattccattttccagtacaaagag |
37448947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 37449053 - 37449100
Alignment:
| Q |
302 |
ggtcatatctttaaatatccattgttatataagaaaatatagtatcat |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37449053 |
ggtcatatctttaaatatccattgttatataagaaaatatagtatcat |
37449100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University