View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20255_low_6 (Length: 298)
Name: NF20255_low_6
Description: NF20255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20255_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 13 - 279
Target Start/End: Original strand, 36207128 - 36207398
Alignment:
| Q |
13 |
atactagtacatcaaaataaaacatggacccaacacatgtctatatctatataataacaaccttagcccacataaaatttac----attcccaacttttt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36207128 |
atactagtacatcaaaataaaacatggacccaacacatgtctatatctatataataacaaccttagcccacataaaatttacttacattcccaacttttt |
36207227 |
T |
|
| Q |
109 |
gtccctttaagcctgtgtggcatatcattgttacataaactatgaaaatgaagcagttccacttgttgcttctcttcactattcttctcttccttacacc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36207228 |
gtccctttaagcctgtgtggcatatcattgttacataaactatgaaaatgaagcagttccacctgttccttctcttcactattcttctcttccttacacc |
36207327 |
T |
|
| Q |
209 |
tacatcttacaccactaggaccaaattttcaggcccttcaacccaacaacaagcatttcatcgttgggcta |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36207328 |
tacatcttacaccactaggaccaaattttcaggcccttcaacccaacaacaagcatttcatcgttgggcta |
36207398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University