View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20255_low_7 (Length: 236)
Name: NF20255_low_7
Description: NF20255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20255_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 120 - 218
Target Start/End: Original strand, 18328066 - 18328164
Alignment:
| Q |
120 |
ttaagttttctacgtcgttctaattctatttatactaaaagaatatgtgttttttaagtgtactttaagagttaggaggataaggacagttcagtattt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18328066 |
ttaagttttctacgtcgttctaattctatttatagtaaaagaatatgagttttttaagtgtactttaagagttaggaggataaggacagttcagtattt |
18328164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 18327936 - 18328010
Alignment:
| Q |
1 |
tactctctcttttccatgtctctgttcgaattcgaatccttccacgttcttcgccatcgatcgtgcttttacctt |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18327936 |
tactctctcttttccatgtctctgttcgaattcgaatccttccacgttcttcgccatcgatcgtgcttttacctt |
18328010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University