View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20257_high_15 (Length: 257)
Name: NF20257_high_15
Description: NF20257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20257_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 17 - 240
Target Start/End: Complemental strand, 45695159 - 45694936
Alignment:
| Q |
17 |
acctctgaactaaaaactagcaccaatcagttaaatatgtcgtcgttgttgcaacaatgtcaaccctcattcgaatcaattagatttagagaatcaggtt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45695159 |
acctctgaactaaaaactagcaccaatcagttaaatatgtcatcgttgttgcaacaatgtcaaccctcattcgaatcaattagatttagagaatcaggtt |
45695060 |
T |
 |
| Q |
117 |
taagtgagaataatacaaaaggtaatgcaaaccagcatgcaccttgtgaagaaatctctcatattccaccttcctcaaccgtaatgaatttcacccattt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45695059 |
taagtgagaataatacaaaaggtaatgcaaaccagcatgcaccttgtgaagaaatctctcatgttccatcttcctcaaccgtaatgaatttcacccattt |
45694960 |
T |
 |
| Q |
217 |
tgcaaaacctgcggctattgtgaa |
240 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
45694959 |
tgcaaaacctgcggctattgtgaa |
45694936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University