View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20257_low_12 (Length: 303)
Name: NF20257_low_12
Description: NF20257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20257_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 11 - 288
Target Start/End: Original strand, 12694340 - 12694617
Alignment:
| Q |
11 |
ttatactgtatgatactccgaggggttatagtcaacggggaactgatttgtaagggaacataattttcgtacgatacttgtagtttgtgtgaaacttcaa |
110 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12694340 |
ttatattgtatgatactccgaggggttatagtcaatggggaactgatttgtaagggaacataattttcgtacgatacttgtagtttgtgtgaaacttcaa |
12694439 |
T |
 |
| Q |
111 |
gtttgagattagttgctttgaatcatcgacaagtggtagttcgtgaggaccattgataatgtgttgcttggatagatcttgtgttttgtgcaagacttaa |
210 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
12694440 |
gtttgagattagttactttgaatcatcgacaagtggtagttcgtgaggaccattgataatgtgttgctttgatagatcttgtgttttgtgtaagacttaa |
12694539 |
T |
 |
| Q |
211 |
tggttcaaaaagaactttcattcgtaagaagtgatttatgttgagggaggtgctcgcggagagctaagagattgtatc |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12694540 |
tggttcaaaaagaactttcattcgtaagaagtgatttatgttgagggacgtgctcgcggagagctaagagattgtatc |
12694617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University