View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20257_low_22 (Length: 241)
Name: NF20257_low_22
Description: NF20257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20257_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 39786711 - 39786930
Alignment:
| Q |
1 |
tttactaaaaaccgatccaaaccgaattgttacacccctacataggattgtacaatgatgcacaaaaataatgtttcatggttgtagcgtcattaaccac |
100 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||| ||||| ||||||| ||||||||||| | |||||||||| ||||||| ||||||||||| |
|
|
| T |
39786711 |
tttactaaaaatcgattcaaaccgaattgttacacccctacgtaggactgtacaacgatgcacaaaactcatgtttcatgattgtagcatcattaaccac |
39786810 |
T |
 |
| Q |
101 |
aagagagaataaacgtatttatagtggagttatgcaccaaagactgtgccaacgaatcattccatgaagggagaaaatcatactcgaacatgagctccac |
200 |
Q |
| |
|
| |||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39786811 |
a-gagagaataaacatgtttatagtggagttatgcaccaaagactgtgccaacgaatcattccatgaagggagaaaatcatactcgaacatgagctccac |
39786909 |
T |
 |
| Q |
201 |
aatccactcaacaagggaatt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
39786910 |
aatccactcaacaagggaatt |
39786930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 40
Target Start/End: Original strand, 44471704 - 44471737
Alignment:
| Q |
7 |
aaaaaccgatccaaaccgaattgttacaccccta |
40 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
44471704 |
aaaaaccgatccaaaccgaactgttacaccccta |
44471737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University