View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20257_low_30 (Length: 205)
Name: NF20257_low_30
Description: NF20257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20257_low_30 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 17 - 191
Target Start/End: Original strand, 32581313 - 32581487
Alignment:
| Q |
17 |
agaaactgtatgaggacattctttctctagtgcatatttaatttcatcaatgacctcgaatcctctagctgaattacggttcggatttgaacccttctca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32581313 |
agaaactgtatgaggacattctttctctagtgcatatttaatttcatcaatgacctcgaatcctctagctgaattacggttcggatttgaacccttctca |
32581412 |
T |
|
| Q |
117 |
ctaataatgcttccactgttatctaacaatattgaagcatcacaaccctgcaacatgatcaacttcttagtataa |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32581413 |
ctaataatgcttccactgttatctaacaatattgaagcatcacaaccctgcaacatgatcaacttcttagtataa |
32581487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 143 - 185
Target Start/End: Original strand, 32579689 - 32579731
Alignment:
| Q |
143 |
caatattgaagcatcacaaccctgcaacatgatcaacttctta |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32579689 |
caatattgaagcatcacaaccctgcaacatgatcaacttctta |
32579731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 21 - 169
Target Start/End: Complemental strand, 8079051 - 8078903
Alignment:
| Q |
21 |
actgtatgaggacattctttctctagtgcatatttaatttcatcaatgacctcgaatcctctagctgaattacggttcggatttgaacccttctcactaa |
120 |
Q |
| |
|
||||| || ||||| |||||||||| || |||||||||| ||||| || || ||||||||||||||||||||||| |||||||| | ||| || || | |
|
|
| T |
8079051 |
actgtctggggacactctttctctacggcggatttaatttcttcaattacttcaaatcctctagctgaattacggtttggatttgaccgcttttcgctga |
8078952 |
T |
|
| Q |
121 |
taatgcttccactgttatctaacaatattgaagcatcacaaccctgcaa |
169 |
Q |
| |
|
| || |||||||| |||||| ||| | || ||||||||||||||||| |
|
|
| T |
8078951 |
tgattgttccactgctatctagcaacaccgatgcatcacaaccctgcaa |
8078903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University