View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20257_low_8 (Length: 365)
Name: NF20257_low_8
Description: NF20257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20257_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 121 - 348
Target Start/End: Original strand, 353996 - 354223
Alignment:
| Q |
121 |
tgtgatgtttgtttttgaaggttaagtttgccactataacaaagaagcttgatcaaaagactcagaaactcggacccgcagttggttatgtctgatctgt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
353996 |
tgtgatgtttgtttttgaaggttaagtttgccactataacaaagaagcttgatcagaagactcagaaactcggacccgcagttggttatgtctgatctat |
354095 |
T |
 |
| Q |
221 |
tgaaggttgaagggaaggagacaagtgaaattcatacattatgtaactgtaaagtagagaattagctttattctttccctctattactccataattgtga |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
354096 |
tgaaggttgaagggaaggagacaagtgaaattcatacattatgtaactgtaaagtagagaattagctttattctttccctctattactccataattgtga |
354195 |
T |
 |
| Q |
321 |
tcattgctggagcagtgttatggattct |
348 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
354196 |
tcattgctggagcagtgttatggattct |
354223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 353876 - 353931
Alignment:
| Q |
1 |
agagagaaagaaacatgtaagaacgaagaaagagtgaatcttttgctatttttatt |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
353876 |
agagagaaagaaacatgtaagaacgaagaaagagtgaatcttttgctatttttatt |
353931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University