View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20257_low_9 (Length: 352)
Name: NF20257_low_9
Description: NF20257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20257_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 17 - 54
Target Start/End: Original strand, 35019197 - 35019234
Alignment:
| Q |
17 |
taggcaactaatacaatgatgaataggtgctaattaat |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35019197 |
taggcaactaatacaatgatgaataggtgctaattaat |
35019234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 283 - 315
Target Start/End: Complemental strand, 8940002 - 8939970
Alignment:
| Q |
283 |
tgatagattattttaaaatttcaataaagtaga |
315 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
8940002 |
tgatagattattttaaaatttcaataaattaga |
8939970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University