View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20258_low_4 (Length: 233)

Name: NF20258_low_4
Description: NF20258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20258_low_4
NF20258_low_4
[»] chr2 (2 HSPs)
chr2 (18-104)||(1612108-1612195)
chr2 (154-220)||(1612245-1612311)


Alignment Details
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 18 - 104
Target Start/End: Original strand, 1612108 - 1612195
Alignment:
18 gaattggatttgatgcatttgaaaa-agtaatgatctcattttggggtttgtttttaaggagtttggtgaagcatgtaaagattgaat 104  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1612108 gaattggatttgatgcatttgaaaaaagtaatgatctcattttggggtttgtttttaaggagtttggtgaagcatgtaaagattgaat 1612195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 154 - 220
Target Start/End: Original strand, 1612245 - 1612311
Alignment:
154 ttacgttggcagcatgtgtgttaagtattcagaaacactttttgtgccaagtagataacttctctgc 220  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1612245 ttacgttggcagcatgtgtgttaagtattcagaaacactttttgtgccaagtagataacttctctgc 1612311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University