View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20258_low_4 (Length: 233)
Name: NF20258_low_4
Description: NF20258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20258_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 18 - 104
Target Start/End: Original strand, 1612108 - 1612195
Alignment:
| Q |
18 |
gaattggatttgatgcatttgaaaa-agtaatgatctcattttggggtttgtttttaaggagtttggtgaagcatgtaaagattgaat |
104 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1612108 |
gaattggatttgatgcatttgaaaaaagtaatgatctcattttggggtttgtttttaaggagtttggtgaagcatgtaaagattgaat |
1612195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 154 - 220
Target Start/End: Original strand, 1612245 - 1612311
Alignment:
| Q |
154 |
ttacgttggcagcatgtgtgttaagtattcagaaacactttttgtgccaagtagataacttctctgc |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1612245 |
ttacgttggcagcatgtgtgttaagtattcagaaacactttttgtgccaagtagataacttctctgc |
1612311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University