View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20259_high_7 (Length: 248)
Name: NF20259_high_7
Description: NF20259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20259_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 8e-42; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 152 - 238
Target Start/End: Complemental strand, 1229069 - 1228983
Alignment:
| Q |
152 |
caccttgtcttcctttcttgctttgtgattcattccagcaattcttatcccacaaatgagcttcatatcgaccggtccaacgatgtc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1229069 |
caccttgtcttcctttcttgctttgtgattcattccagcaattcttatcccacaaatgagcttcatatcgaccggtccaacgatgtc |
1228983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 18 - 99
Target Start/End: Complemental strand, 1229203 - 1229122
Alignment:
| Q |
18 |
attgccatcaccaacaaaaacaacataacaaaagattacatcaaatcaaacaattaagtgaatgagatcagaacgataaaac |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1229203 |
attgccatcaccaacaaaaacaacataacaaaatattacatcaaatcaaacaattaagtgaattagatcagaacgataaaac |
1229122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 153 - 233
Target Start/End: Complemental strand, 54267122 - 54267042
Alignment:
| Q |
153 |
accttgtcttcctttcttgctttgtgattcattccagcaattcttatcccacaaatgagcttcatatcgaccggtccaacg |
233 |
Q |
| |
|
||||||||| ||||||||| | || || |||||||| |||||||| ||||||||||||||||||||||| || |||||||| |
|
|
| T |
54267122 |
accttgtctccctttcttgttctgagactcattccaacaattcttgtcccacaaatgagcttcatatcggcctgtccaacg |
54267042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 153 - 218
Target Start/End: Complemental strand, 25049855 - 25049790
Alignment:
| Q |
153 |
accttgtcttcctttcttgctttgtgattcattccagcaattcttatcccacaaatgagcttcata |
218 |
Q |
| |
|
|||||||| |||||| ||| |||| ||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
25049855 |
accttgtcgtccttttttgttttgcgattcattccaacaattcttgtcccacaaatgagcttcata |
25049790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University