View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20259_low_4 (Length: 354)
Name: NF20259_low_4
Description: NF20259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20259_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 11 - 336
Target Start/End: Complemental strand, 49703738 - 49703413
Alignment:
| Q |
11 |
agatgaatgatgtaagtgatatactacttaccgtaattggcagcagatatcatcccgaaaattgaattatgaaaggtgttggccctttgcctccgatgac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49703738 |
agatgaatgatgtaagtgatatactacttaccgtaattggcagcagatatcatcccgaaaattgaattatgaaaggtgttggccctttgcctccgatgac |
49703639 |
T |
|
| Q |
111 |
tatctaaccatggcaactcttcttgattaggtggttgtagcatgttatctagggatccacgagcatcaggcataacgggtgcactttgaaacgacgacac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49703638 |
tatctaaccatggcaactcttcttgattaggtggttgtagcatgttatctagggatccacgagcatcaggcataacgggtgcactttgaaacgacgacac |
49703539 |
T |
|
| Q |
211 |
attaggcgtaccatcttctggtattggactaacaggtgctatttgtttgttttctttaatgttttggaatatattttgaatttcgtcgtggccttgattt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
49703538 |
attaggcgtaccatcttctggtattggactaacaggtgctgtttgtttgttttctttaatgttttggaatatatttttaatttcatcgtggccttgattt |
49703439 |
T |
|
| Q |
311 |
tctgccaaagcccttggagtccagcc |
336 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
49703438 |
tctgccaaagcccttggagtccagcc |
49703413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University