View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2025_low_6 (Length: 252)
Name: NF2025_low_6
Description: NF2025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2025_low_6 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 8 - 252
Target Start/End: Original strand, 4680462 - 4680705
Alignment:
| Q |
8 |
caacacagaggcagaaaacagaagagaaaaaacaaggtttcaaattgcggccgcagttgcgctggcaattacaatccttcatattactgaaaattgcagc |
107 |
Q |
| |
|
||||||| ||||||||||||||||||| ||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4680462 |
caacacaaaggcagaaaacagaagagagaaa-caagctttcaaattgcggccgcagttgcgctggcaattacaatccttcatattactgaaaattgcagc |
4680560 |
T |
|
| Q |
108 |
cacgattgcaatcatgatgcagacgtgacgtgagaacttcaaaattcttgatgttgtggctacaattgtaattgccgaccacaacttaaaaccttggaga |
207 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4680561 |
cacgattgcaatcatgatgcagacgtggcatgagaacttcaaaattcttgatgttgtggctacaattgtgattgccgaccacaacttaaaaccttggaga |
4680660 |
T |
|
| Q |
208 |
gaaacaacccacctgtagctttatcagccaggaaaattagtcctg |
252 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4680661 |
gaaacaacccacctgtagctttatcggccaggaaaattagtcctg |
4680705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University