View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20260_high_15 (Length: 227)
Name: NF20260_high_15
Description: NF20260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20260_high_15 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 8 - 227
Target Start/End: Original strand, 16085822 - 16086043
Alignment:
| Q |
8 |
tatatggttaatgaacaaaatgacatttctgttaaaagcttaattttgcgtcggaaaatgttttttacctggtgcttatagtaggcttattatgagacat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16085822 |
tatatggttaatgaacaaaatgacatttctgttaaaagcttaattttgcgtcggaaaatgttttttacctggtgcttatagtaggcttattatgagacat |
16085921 |
T |
 |
| Q |
108 |
gttggttaggg--tgaggttagctctgcaggatggttctggtgcctattcgtaaggttattcatcggtggtttaaacctttaagtttcaagtatagttgt |
205 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16085922 |
gttggttagggggtgaggttagctctgcaggatggttctggtgcctattcgtaaggttattcatcggtggtttaaacctttaagtttcaagtatagttgt |
16086021 |
T |
 |
| Q |
206 |
aattgttttgagttctccttat |
227 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
16086022 |
aattgttttgagttctccttat |
16086043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University