View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20260_low_6 (Length: 343)
Name: NF20260_low_6
Description: NF20260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20260_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 57 - 326
Target Start/End: Original strand, 8335487 - 8335752
Alignment:
| Q |
57 |
ccttaaaaattaaggcggataagaatttaatcagtattacgtgaaattatgactagatacatacatagcttagtacctataaatacctgaatgttgttga |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8335487 |
ccttaaaaattaaggcggataagaatttaatcagtattacgtgtaattatgactagatac----atagcttagtatctataaatacctgaatgttgttga |
8335582 |
T |
 |
| Q |
157 |
cactatattgtaagaaaatcagaaagctaatagtaagatggaaaagttaatgtgggttagattgacaatttttcttgttttatttgtcagtaaagtatcc |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
8335583 |
cactatattgtaagaaaatcagaaagctaatagtaagatggaaaagttaatgtgggttagattgacaatttttattgttttatttggcagtaaagtatca |
8335682 |
T |
 |
| Q |
257 |
aatattgcaattgcacaaactacgaatgcagcagcatttccagcagtgtttgcatttggggactcaatct |
326 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8335683 |
aatattgcaattgcacaaactacgaatgcagcagcatttcctgcagtgtttgcatttggggactcaatct |
8335752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University