View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20261_high_40 (Length: 273)
Name: NF20261_high_40
Description: NF20261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20261_high_40 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 13 - 258
Target Start/End: Original strand, 10383170 - 10383415
Alignment:
| Q |
13 |
gagaggatgaacatggtacggttttataggtctttgacgcggaagggttgaaaactggatcttcttgtatatgacagtatatagtacaaggttggcattg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10383170 |
gagaggatgaacatggtacggttttataggtctttgacgcggaagggttgaaaactggatcttcttgtatatgacagtatatagtacaaggttggcattg |
10383269 |
T |
|
| Q |
113 |
gagccaggaaaaggaactaccagtgtctacaatcatggtatagtactttgtagggctaccaagtcccattttcacatagtaattgcctgaacccattgat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10383270 |
gagccaggaaaaggaactaccagtgtctacaatcatggtatagtactttgtagggctaccaagtcccattttcacatagtaatttcctgaacccattgat |
10383369 |
T |
|
| Q |
213 |
aaacctgatttcaatggtatgccggcaagttttggacctaccttct |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10383370 |
aaacctgatttcaatggtatgccggcaagttttggacctaccttct |
10383415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University