View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20261_high_55 (Length: 239)
Name: NF20261_high_55
Description: NF20261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20261_high_55 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 30 - 239
Target Start/End: Complemental strand, 23012938 - 23012726
Alignment:
| Q |
30 |
atatttgctatgtgtgtggaacattaatatatgtcgctattggagcatgtgtta--------gtatgattatctatctaactatggatgaaatcaaatta |
121 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23012938 |
atatttgctatgtgtgtggaatattaatatatgtcgctattggagcatgtgttacagtgttagtatgattatctatctaactatggatgaaatcaaatta |
23012839 |
T |
 |
| Q |
122 |
ttattccgtcaacaaataatataatatgaatactaacagtattccctcaacnnnnnnnnnnnnnngaatactaacagttttgttagagttatcctgagtt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23012838 |
ttattccgtcaacaaataatataatatgaatactaacagtattccctaa-----taaaaaaaaatgaatactaacagttttgttagagttatccggagtt |
23012744 |
T |
 |
| Q |
222 |
cagaaccaataattgttt |
239 |
Q |
| |
|
||||||||||| |||||| |
|
|
| T |
23012743 |
cagaaccaatagttgttt |
23012726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University