View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20261_high_57 (Length: 238)
Name: NF20261_high_57
Description: NF20261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20261_high_57 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 187
Target Start/End: Complemental strand, 9716495 - 9716309
Alignment:
| Q |
1 |
ttcctaacatcaaaagttattgacctttt-acaaaaagtttaatggattatgaatatcagtgttgtctcacctaagtccatgatggacatcaagggtaaa |
99 |
Q |
| |
|
|||||||||||||||||| |||| ||||| ||||| ||||||||||||||||||||| ||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
9716495 |
ttcctaacatcaaaagttgttgaactttttacaaagagtttaatggattatgaatat-agtgttgtcgcacctaagtccatgatggacattaagggtaaa |
9716397 |
T |
 |
| Q |
100 |
catgattaactaatatcatcttcttcattccctcgtttaactctaagcatcttccattcttgcatcttgtgcttttaattactctcga |
187 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
9716396 |
catgattaactaatatcatgttcttcattctctcgtttaactctaagcatcttccattcttgtatcttatgcttttaattactctcga |
9716309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University