View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20261_high_60 (Length: 235)

Name: NF20261_high_60
Description: NF20261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20261_high_60
NF20261_high_60
[»] chr5 (2 HSPs)
chr5 (17-77)||(18403854-18403914)
chr5 (166-218)||(18403716-18403768)


Alignment Details
Target: chr5 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 17 - 77
Target Start/End: Complemental strand, 18403914 - 18403854
Alignment:
17 aatatccacacacaaaaaataccatgtccagcttcactcatgccactacactactccatgc 77  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18403914 aatatccacacacaaaaaataccatgtccagcttcactcatgccactacactactccatgc 18403854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 166 - 218
Target Start/End: Complemental strand, 18403768 - 18403716
Alignment:
166 aatagaagaaatttagtttcaacatttctagcaacatcattggttggagtagt 218  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||    
18403768 aatagaagaaatttagtttcaacatttctagcaacatcaatggttggagtagt 18403716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University