View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20261_high_68 (Length: 211)

Name: NF20261_high_68
Description: NF20261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20261_high_68
NF20261_high_68
[»] chr7 (1 HSPs)
chr7 (1-191)||(37511594-37511784)
[»] chr4 (1 HSPs)
chr4 (67-193)||(53752933-53753059)
[»] chr1 (1 HSPs)
chr1 (1-52)||(40225067-40225118)
[»] chr3 (1 HSPs)
chr3 (1-33)||(51588092-51588124)


Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 37511784 - 37511594
Alignment:
1 ttggtttcacggcgagttcgccgccgccaacgcgatcattgatgctctctgtggtcaccttgcgcagattgctccatcctccaacgattacgattcagct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37511784 ttggtttcacggcgagttcgccgccgccaacgcgatcattgatgctctctgtggtcaccttgcgcagattgctccatcctccaacgattacgattcagct 37511685  T
101 tttacggccgtacaccggcggcggttcaactggatccctgttattcagatgcagaagtatcattctattgctgatgtgactctcgagcttc 191  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37511684 tttacggccgtacaccggcggcggttcaactggatccctgttattcagatgcagaagtatcattctattgctgatgtgactctcgagcttc 37511594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 67 - 193
Target Start/End: Complemental strand, 53753059 - 53752933
Alignment:
67 gattgctccatcctccaacgattacgattcagcttttacggccgtacaccggcggcggttcaactggatccctgttattcagatgcagaagtatcattct 166  Q
    |||||||||||| |||||||||| |||||  |||||||||| |||||||||||||||| ||||||||||||||||||||| |||||| | |||||||||     
53753059 gattgctccatcttccaacgattgcgattttgcttttacggtcgtacaccggcggcggctcaactggatccctgttattctgatgcaaaggtatcattcc 53752960  T
167 attgctgatgtgactctcgagcttcgt 193  Q
    |||| |||||||||||| |||||||||    
53752959 attgttgatgtgactcttgagcttcgt 53752933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 40225118 - 40225067
Alignment:
1 ttggtttcacggcgagttcgccgccgccaacgcgatcattgatgctctctgt 52  Q
    |||||||||||||||||||||||| |||||||| ||||| || |||||||||    
40225118 ttggtttcacggcgagttcgccgctgccaacgcaatcatcgacgctctctgt 40225067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 51588092 - 51588124
Alignment:
1 ttggtttcacggcgagttcgccgccgccaacgc 33  Q
    |||||||||||||||||||||||| ||||||||    
51588092 ttggtttcacggcgagttcgccgctgccaacgc 51588124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University