View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20261_low_28 (Length: 316)
Name: NF20261_low_28
Description: NF20261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20261_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 26 - 296
Target Start/End: Complemental strand, 43300965 - 43300695
Alignment:
| Q |
26 |
aagtgaactgagattggagtttgaaacctaagagcggtggtgagatgttacgggttcagagcgtggtgttgaactgtagaagaaaacgagaacgaggaag |
125 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43300965 |
aagtgaactgagactggagtttgaaacctaagagcggtggtgagatgttacgggttcagagcgtggtgttgaactgtagaagaaaacgagaacgaggaag |
43300866 |
T |
 |
| Q |
126 |
aaagaaggtgctagaacaaatatgcagaaatggttacggtgggacttagggtagagtattcaattctcattggacaggcccagagtaatgagctgggctt |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
43300865 |
aaagaaggtgctagaacaaatatgcagaaatggttacggtgggacttagggtagagtattcaattctcattggacaggcccaaagtaatcagctgggctt |
43300766 |
T |
 |
| Q |
226 |
cactccctactattttattgaaatttctccccccacctcccccacacctaaaaaataggaaagagtcgtaa |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43300765 |
cactccctactattttattgaaatttctccccccacctcccccacaccaaaaaaataggaaagagtcgtaa |
43300695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University