View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20261_low_30 (Length: 302)
Name: NF20261_low_30
Description: NF20261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20261_low_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 4e-50; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 149 - 290
Target Start/End: Original strand, 32207753 - 32207894
Alignment:
| Q |
149 |
catttagaacgatgaagaaannnnnnnatcgaataaattattcaaatataagatttcaaactgaaatcaatattttattttttcactaatcataaaattt |
248 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32207753 |
catttagaacgatgaagaaatttttttatcaaataaattattcaaatataagatttcaaactgaaatcaatattttattttttcactaatcataaaattt |
32207852 |
T |
|
| Q |
249 |
atttgtgcagtataacttgtgcattgcaacaacacacaggtt |
290 |
Q |
| |
|
||||||| |||| || |||||| ||||||||||||||||||| |
|
|
| T |
32207853 |
atttgtgtagtacaatttgtgcgttgcaacaacacacaggtt |
32207894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 176 - 290
Target Start/End: Original strand, 32221167 - 32221283
Alignment:
| Q |
176 |
atcgaataaattat--tcaaatataagatttcaaactgaaatcaatattttattttttcactaatcataaaatttatttgtgcagtataacttgtgcatt |
273 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32221167 |
atcgaataaattatgatcaaatataagatttcaaactgaaatcaatattttatttttccactaatcataaaatttatttgtgcggtataacttgtgcatt |
32221266 |
T |
|
| Q |
274 |
gcaacaacacacaggtt |
290 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
32221267 |
gcaacaacacacaggtt |
32221283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 40 - 89
Target Start/End: Original strand, 32207644 - 32207693
Alignment:
| Q |
40 |
aattttactacatgattgcgattgtgatttcagttttactgattaaatcg |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32207644 |
aattttactacatgattgcgattgtgatttcagttttactgattaaatcg |
32207693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 50 - 89
Target Start/End: Original strand, 32220876 - 32220915
Alignment:
| Q |
50 |
catgattgcgattgtgatttcagttttactgattaaatcg |
89 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32220876 |
catgattgtgattgtgatttcagttttactgattaaatcg |
32220915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University