View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20261_low_39 (Length: 282)
Name: NF20261_low_39
Description: NF20261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20261_low_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 4e-75; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 117 - 267
Target Start/End: Original strand, 24887004 - 24887154
Alignment:
| Q |
117 |
ttttaccatttttcaacaaatatttttatattagtttccttaataaaatgttttaagaggactatttaactttctttttatatcacgaaaaggcaagtgt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24887004 |
ttttaccatttttcaacaaatatttttatattagtttccttaataaaatgttttaagagcactatttaactttctttttatatcacgaaaaggcaagtgt |
24887103 |
T |
 |
| Q |
217 |
gcaaaagataataatattaagatgtaagaagtttgtagtgtggaaagaagt |
267 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24887104 |
gaaaaagataataatattaagatgtaagaagtttgtagtgtggaaagaagt |
24887154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 14 - 46
Target Start/End: Original strand, 24886911 - 24886943
Alignment:
| Q |
14 |
attatactaataagtgtcttaaagatattaatt |
46 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
24886911 |
attatactaataagtgtcttaaagatattaatt |
24886943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University